Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: FNDC5 deficiency aggravated HFD-induced inflammation in heart. a Cardiac Tnf - α, Il1b and Il6 mRNA levels determined with qPCR. b Phosphorylation levels of p38 and ERK in heart determined with Western blot. c NFκB activation in heart. N-p65: p65 in nucleus; C-p65: p65 in cytoplasm. Values are mean ± SEM. *P < 0.05 vs. WT. † P < 0.05 vs. Ctrl. n = 3

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques: Western Blot, Activation Assay

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: FNDC5 deficiency enhanced HFD-induced oxidative stress and phosphorylated JAK2 and STAT3 level in heart. a Superoxide dismutase (SOD) activity and malondialdehyde (MDA) level in heart. b Expression of NAPDH oxidases (NOX2 and NOX4) protein in heart. c Phosphorylated JAK2 and STAT3 level in heart. Values are mean ± SEM. *P < 0.05 vs. WT. † P < 0.05 vs. Ctrl. n = 6

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques: Activity Assay, Expressing

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: FNDC5 deficiency enhanced palmitate-induced inflammation and NOX4 expression in primary cardiomyocytes (CMs). a Effects of palmitate (PA, 400 μM) treatment on Tnf - α, Il1b and Il6 mRNA levels in CMs of WT and FNDC5 −/− mice. b Effects of PA treatment on NOX2 and NOX4 protein level in CMs of WT and FNDC5 −/− mice. The measurement was 24 h after PA treatment for measuring the mRNA levels or protein levels. PA: Palmitate; Veh: Vehicle; F −/− : FNDC5 −/− . Values are mean ± SEM. *P < 0.05 vs. Veh. † P < 0.05 vs. CMs-WT. n = 3

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques: Expressing

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: Exogenous FNDC5 pretreatment attenuated palmitate-induced inflammation and oxidative stress in CMs. a , b Effects of exogenous FNDC5 pretreatment on cardiac hypertrophy markers ( Nppa, Nppb and Myh7 ) and inflammation markers ( Tnf - α, Il1b and Il6 ) mRNA levels in PA-stimulated CMs. c Effects of exogenous FNDC5 pretreatment on NO production in cell culture supernatant of PA-stimulated CMs. d Effects of exogenous FNDC5 pretreatment on NOX expression in PA-stimulated CMs. PA: Palmitate; Veh: Vehicle. Values are mean ± SEM. *P < 0.05 vs. Veh. † P < 0.05 vs. PA. n = 6

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques: Cell Culture, Expressing

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: FNDC5 overexpression (OE) attenuated cardiac hypertrophy, inflammation and oxidative stress in HFD-fed mice. a , b Serum and heart/muscle FNDC5 levels after lentiviral vector-mediated FNDC5 overexpression. c Cardiomyocyte area in heart determined by H&E staining. d , e mRNA levels of the cardiac hypertrophy markers ( Nppa, Nppb and Myh7 ) and inflammation markers ( Tnf - α, Il1b and Il6 ). f SOD activity and MDA level in heart. g NOX2, NOX4 level and NFκB inactivation in heart. h Phosphorylation levels of p38 and ERK in heart. Values are mean ± SEM. *P < 0.05 vs. vector. n = 6

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques: Over Expression, Plasmid Preparation, Staining, Activity Assay

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: Schematic illustrates a possible mechanism of FNDC5 in obesity-induced cardiac hypertrophy. Obesity-induced lipid overload has a great impact on the production of reactive oxygen species (ROS) and upregulation of TNF-α, IL-1β and IL-6 levels, which leads to cardiac inflammation and oxidative stress. The enhanced cardiac inflammation and oxidative stress are involved in pathogenesis of cardiac injury and remodeling. FNDC5 may exert its protective function on the enhanced inflammation and oxidative stress via JAK2/STAT3 pathway through an unknown receptor

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques:

Journal: Journal of Translational Medicine

Article Title: FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress

doi: 10.1186/s12967-019-1857-8

Figure Lengend Snippet: Echocardiographic assessment of left ventricle functions in mice

Article Snippet: The FNDC5 specific siRNA (sense sequence: 5′GAUGGCCUCUAAGAACAAA3′; antisense sequence: 3′CUACCGGAGAUUCUUGUUU5′) was purchased from RiboBio (Guangzhou, China).

Techniques:

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: RECK (reversion-inducing cysteine-rich protein with Kazal motifs) regulates migration, differentiation and Wnt/β-catenin signaling in human mesenchymal stem cells

doi: 10.1007/s00018-015-2054-4

Figure Lengend Snippet: Influence of RECK on MMP and TIMP expression in hMSCs. Cells were treated with control siRNA (NC) and two different siRNAs targeting RECK (S1, S2). a Relative mRNA expression of RECK was quantified by qRT-PCR analysis on day 1, 3, 7 and 10 after transfection and normalized to GAPDH mRNA. b Protein levels of RECK in cell extracts were determined by Western blotting on day 3, 7, 10 and 14 after transfection. For densitometric quantification, the amount of RECK present in cells transfected with control siRNA was set to 100 % at each time point. Cellular β-actin was used as a loading control. hMSCs were transfected with siRNA 2 (S2) against RECK (KD) and control siRNA (NC). Relative mRNA expression of MMP-2 (c), MT1-MMP (d), TIMP-1 (e) and TIMP-2 (f) was quantified by qRT-PCR analysis on day 1, 3 and 7 after transfection. Values were normalized to GAPDH mRNA. Protein levels of MMP-2 (c) as well as TIMP-1 (e) and TIMP-2 (f) were determined in supernatants after 7 days of cell cultivation analyzing equal amounts of protein by zymography and Western blotting, respectively. MT1-MMP (d) was detected in 7 day-cell extracts by Western blotting. Here, β-actin served as a loading control. Results of densitometric quantification are given in densitometric units (DU) with the amounts of protein present in control cells set as 100 %. Data shown represent the mean ± SD of triplicate measurements (n = 3). **P < 0.01; ***P < 0.001

Article Snippet: RECK siRNA 1 (sense sequence: AAAUUAUUGCGCCUCUAUUTT, antisense sequence: AAUAGAGGCGCAAUAAUUUTC) was synthesized by Qiagen (Hilden, Germany), while RECK siRNA 2 (sense sequence: AAUAGAGGCGCAAUAAUUUCCCCC, antisense sequence: GGGGGAAAUUAUUGCGCCUCUAUU) was provided by Riboxx (Radebeul, Germany).

Techniques: Expressing, Quantitative RT-PCR, Transfection, Western Blot, Zymography

Journal: iScience

Article Title: Rab33b-exocyst interaction mediates localized secretion for focal adhesion turnover and cell migration

doi: 10.1016/j.isci.2022.104250

Figure Lengend Snippet: siRNA screen to identify Rab proteins affecting cell migration (A) U2OS cells transfected with control siRNA or pools of four different siRNAs against human Rabs were grown to confluency, scratch-wounded, and imaged every 3 h. The graph shows the relative wound density at 18 h after wounding represented as mean ± SEM of four independent experiments. The red solid line indicates the relative wound density (%) and the dashed red lines the boundaries of the SEM for cells transfected with control siRNA. (B) Representative images are shown for time 0 and 18 h after wounding for the two Rabs whose depletion had the strongest effect on wound closure. Scale bar: 200 μm. (C) U2OS cells transfected with control siRNA or a pool of four different siRNAs targeting Rab33b were imaged for 48 h. The rate of proliferation (measured as percentage of cell confluence) over time is shown as mean ± SEM of three independent experiments. (D) U2OS cells were transfected with control siRNA or each of the different individual four siRNAs present in the pool targeting Rab33b (Rab33b siRNA_1, siRNA_2, siRNA_3, or siRNA_4), grown to confluency, scratch-wounded, and imaged every 3 h. Representative images for time 0 and 24 h after wounding are shown. Scale bar: 200 μm. (E) Graph showing the relative wound density (%) over time for each sample in (d). The graph represents the mean ± SEM of a minimum of three independent experiments. ∗p < 0.05, ∗∗p < 0.01, n.s. not significant, for t = 24h (two-tailed paired Student′s t-test). (F) Lysates from U2OS cells transfected with control siRNA, or with each of the different individual four siRNAs present in the pool targeting Rab33b were subjected to Western blot analysis with the indicated antibodies.

Article Snippet: Non-targeting control siRNA (sense sequence 5′-ACUUCGAGCGUGCAUGGCUTT-3′ and antisense 5′-AGCCAUGCACGCUCGAAGUTT-3′) was purchased from MWG-Biotech (Ebersberg, Germany).

Techniques: Migration, Transfection, Two Tailed Test, Western Blot

Journal: iScience

Article Title: Rab33b-exocyst interaction mediates localized secretion for focal adhesion turnover and cell migration

doi: 10.1016/j.isci.2022.104250

Figure Lengend Snippet: Rab33b depletion promotes cell migration (A) U2OS cells transfected with either control siRNA, Rab33b siRNA_1, Rab33b siRNA_2, treated with the same siRNAs against Rab33b and afterwards transfected with GFP-Rab33b or transiently transfected with GFP, or GFP-Rab33b T47N, were scratch-wounded and imaged every 3 h. Representative images for time 0 and 23 h after wounding are shown. Scale bar: 200 μm. (B) Graph showing relative wound density (%) for each sample in (a) over time. The graph represents the mean ± SEM of a minimum of three independent experiments. ∗p < 0.05, n.s., not significant, for t = 24h (two-tailed paired Student′s t-test). (C) Cell lysates from cells treated with control siRNA, Rab33b siRNA_1, Rab33b siRNA_2, or treated with the same siRNAs against Rab33b and afterwards transfected with GFP-Rab33b were subjected to Western blot analysis with antibodies against Rab33b and tubulin (as loading control). (D) Representative track plots of the single-cell distances of migration for cells transfected with control siRNA, Rab33b siRNA_1, Rab33b siRNA_2, or treated with the same siRNAs against Rab33b and afterwards transfected with GFP-Rab33b. Individual tracks are shown so that each starts at the origin (distance 0). (E) Quantification of the mean ± SEM of the single cell speed from at least three independent experiments. n > 30 cells per condition and per experiment. ∗p < 0.05, ∗∗p < 0.01, n.s., not significant (two-tailed paired Student′s t-test). See also Figures S1 A–S1B

Article Snippet: Non-targeting control siRNA (sense sequence 5′-ACUUCGAGCGUGCAUGGCUTT-3′ and antisense 5′-AGCCAUGCACGCUCGAAGUTT-3′) was purchased from MWG-Biotech (Ebersberg, Germany).

Techniques: Migration, Transfection, Two Tailed Test, Western Blot

Journal: iScience

Article Title: Rab33b-exocyst interaction mediates localized secretion for focal adhesion turnover and cell migration

doi: 10.1016/j.isci.2022.104250

Figure Lengend Snippet: Rab33b is involved in the regulation of focal adhesion dynamics (A) U2OS cells silenced with control siRNA, Rab33b siRNA_1, or Rab33b siRNA_2, were fixed and stained with DAPI, rhodamine-conjugated phalloidin, and an antibody against vinculin. Scale bar: 5 μm. (B–C) Quantification of FA number per 100 μm 2 cell area (b) and size (c). The graphs represent the mean ± SEM for three independent experiments (n > 90 cells). ∗p < 0.05, n.s., not significant (two-tailed paired Student′s t-test). (D) Control or Rab33b-depleted cells transfected with RFP-vinculin were imaged every 10 min for 40 min. Arrows show FA disassembly, and arrowheads show FA assembly. Scale bar: 10 μm. (E) Rainbow color representation of FA assembly and disassembly over time from cells shown in panel (d). Each time point is shown in a different color, as indicated in the bar. Insets show magnifications of the boxed areas. Scale bar: 10 μm. (F) Quantification of assembly and disassembly rates of FAs. The assembly and disassembly rate is shown as percentage of focal adhesion formation or disassembly per minute. The values represent the mean ± SEM from three independent experiments, in which 15 FAs were analyzed per cell (n > 5), per condition, and per experiment. ∗p < 0.05, n.s., not significant (two-tailed paired Student′s t-test). (G) Live-cell imaging of U2OS cells co-transfected with GFP-Rab33b (green) and RFP-vinculin (red). Cells were imaged every 5 s with a Zeiss LSM880 confocal microscope. Magnifications of the boxed areas in the side panels show Rab33b-positive vesicles moving to focal adhesion sites. Scale bar: 5μm, inset: 1μm. See also Figure S2 and Video S1. Rab33b-positive vesicles are delivered to FAs, Live-cell imaging of U2OS cells co-transfected with GFP-Rab33b (green) and vinculin-RFP (red). Magnification of the boxed area 1 in Figure 4g is shown and illustrates two examples of Rab33b-positive vesicles contacting focal adhesions. Cells were imaged every 5 s using a spinning disk confocal microscope. Related to Figure 4. , Video S2. Rab33b-positive vesicles are delivered to FAs,Live-cell imaging of U2OS cells co-transfected with GFP-Rab33b (green) and vinculin-RFP (red). Magnifications of the boxed area 2 in Figure 4g is shown and illustrate two examples of Rab33b-positive vesicles contacting focal adhesions. Cells were imaged every 5 s using a spinning disk confocal microscope. Related to Figure 4. , Video S3. Rab33b-positive vesicles are delivered to growing FAs during membrane protrusion,U2OS cells transiently transfected with GFP-Rab33b (green) and vinculin-RFP (red) were imaged every 30 s using a TIRF microscope with a penetration depth of 90 nm. The movie shows the recruitment of GFP-Rab33b-positive vesicles during membrane protrusion. Related to Figure 4. .

Article Snippet: Non-targeting control siRNA (sense sequence 5′-ACUUCGAGCGUGCAUGGCUTT-3′ and antisense 5′-AGCCAUGCACGCUCGAAGUTT-3′) was purchased from MWG-Biotech (Ebersberg, Germany).

Techniques: Staining, Two Tailed Test, Transfection, Live Cell Imaging, Microscopy

Journal: iScience

Article Title: Rab33b-exocyst interaction mediates localized secretion for focal adhesion turnover and cell migration

doi: 10.1016/j.isci.2022.104250

Figure Lengend Snippet: VSV-G transport to the cell surface is inhibited by Rab33b depletion (A) U2OS cells silenced with control siRNA, siRNA against Rab33b, or silenced with Rab33b siRNA and transfected with RFP-Rab33b (red), were transfected with YFP-VSV-G (green) and incubated at 39°C for 16 h. Cells were then fixed either immediately (T0), 20 min (T20), or 90 min (T90) after a shift to 32°C. Scale bar: 10 μm. (B) Quantification of the VSV-G distribution 90 min after the shift to 32°C. 200 cells were analyzed from three independent experiments and the percentage of cells in which YFP-VSV-G was located at the Golgi, post-Golgi vesicles, and plasma membrane was determined. The graph shows the mean ± SEM ∗p < 0.05, ∗∗p < 0.01, n.s., not significant (two-tailed paired Student′s t-test). See also Figure S4 .

Article Snippet: Non-targeting control siRNA (sense sequence 5′-ACUUCGAGCGUGCAUGGCUTT-3′ and antisense 5′-AGCCAUGCACGCUCGAAGUTT-3′) was purchased from MWG-Biotech (Ebersberg, Germany).

Techniques: Transfection, Incubation, Two Tailed Test

Journal: iScience

Article Title: Rab33b-exocyst interaction mediates localized secretion for focal adhesion turnover and cell migration

doi: 10.1016/j.isci.2022.104250

Figure Lengend Snippet:

Article Snippet: Non-targeting control siRNA (sense sequence 5′-ACUUCGAGCGUGCAUGGCUTT-3′ and antisense 5′-AGCCAUGCACGCUCGAAGUTT-3′) was purchased from MWG-Biotech (Ebersberg, Germany).

Techniques: Transduction, Recombinant, Two Hybrid Screening, Sequencing, Plasmid Preparation, Software